Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.141508 |
Chromosome: | chromosome 12 |
Location: | 8215721 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g550550 | CYG48 | (1 of 70) 4.6.1.2 - Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCGCTGGGTTCTGGCGTAGGAGCAATG |
Internal bar code: | GTGTCCAGTCCCGTGTTGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 577 |
LEAP-Seq percent confirming: | 99.532 |
LEAP-Seq n confirming: | 1914 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCGGTTAGTACAGCCACG |
Suggested primer 2: | GCAGCAACAGAAGCAGTGAC |