| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.141524 |
| Chromosome: | chromosome 16 |
| Location: | 5662337 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679200 | PEX1 | Peroxisome biogenesis protein; (1 of 1) K13338 - peroxin-1 (PEX1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAGCTGAACCTGAACCTGAGTCTGCCGA |
| Internal bar code: | AGGGGTAGCGCATGGATAGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 838 |
| LEAP-Seq percent confirming: | 93.7913 |
| LEAP-Seq n confirming: | 5680 |
| LEAP-Seq n nonconfirming: | 376 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAATGGGGTAGTGAGCGT |
| Suggested primer 2: | CTGCTACTGGAGGACAAGGC |