| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.141570 |
| Chromosome: | chromosome 3 |
| Location: | 6131932 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g191900 | (1 of 1) K11840 - ubiquitin carboxyl-terminal hydrolase 9/24 [EC:3.4.19.12] (USP9_24) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCAGGAGGATTGCAACTTTCTCAATGCC |
| Internal bar code: | CGATCGATATCTAGTTTAAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 728 |
| LEAP-Seq percent confirming: | 96.7949 |
| LEAP-Seq n confirming: | 151 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAAGGGAGTAAAGCGCAG |
| Suggested primer 2: | CCAGGTGGCTTAGACCGTTA |