Insertion junction: LMJ.RY0402.141627_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.141627
Chromosome:chromosome_3
Location:3737907
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g169750 antisense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCCGCACGCCCTCCACAGCGTGACAGTGCA
Internal bar code:ACTATCTCGGTGCTTGAGAGCA

Confirmation - LEAP-Seq

LEAP-Seq distance:938
LEAP-Seq percent confirming:99.6449
LEAP-Seq n confirming:3929
LEAP-Seq n nonconfirming:14
LEAP-Seq n unique pos:22

Suggested primers for confirmation by PCR

Suggested primer 1:GCCACTTGATGATGGGACTT
Suggested primer 2:CATATACCTGCACACCGTCG