| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.141678 |
| Chromosome: | chromosome 3 |
| Location: | 7346011 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g206550 | CPLD2,PGP5 | (1 of 2) PTHR18901//PTHR18901:SF9 - 2-DEOXYGLUCOSE-6-PHOSPHATE PHOSPHATASE 2 // SUBFAMILY NOT NAMED; conserved expressed protein with hydrolase motif | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACGGTCGCGCACACCTCGTCCGAGAGG |
| Internal bar code: | TCGGATGCATAAGGACGTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 334 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGGGCTTCCAACCTACT |
| Suggested primer 2: | GGGCTTGAAGAGAGGGTTCT |