Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.141738 |
Chromosome: | chromosome 3 |
Location: | 378575 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g144847 | PYK4 | (1 of 2) PTHR11817//PTHR11817:SF3 - PYRUVATE KINASE // PYRUVATE KINASE; Pyruvate kinase 4 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCACGTGGCCGGCGGACCGCAGCCTGAC |
Internal bar code: | CGCACAGCTGTGATCGCGGCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 166 |
LEAP-Seq percent confirming: | 89.1304 |
LEAP-Seq n confirming: | 41 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCCGAACAGTTTGCGTAT |
Suggested primer 2: | GACCACATAGCTACCGCCAT |