| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.141844 |
| Chromosome: | chromosome 14 |
| Location: | 557404 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611700 | PLAP8,PLP8 | Plastid lipid associated protein 8; (1 of 1) PF01476//PF04755 - LysM domain (LysM) // PAP_fibrillin (PAP_fibrillin) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTGTGTACATGTGTGTGTACGGAGCA |
| Internal bar code: | CGAGGGGGTTTAAGCGACTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 494 |
| LEAP-Seq percent confirming: | 76.3122 |
| LEAP-Seq n confirming: | 1105 |
| LEAP-Seq n nonconfirming: | 343 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAGCGACAAGGTGGTGTA |
| Suggested primer 2: | GGAGACGTTGTAGATGCGGT |