| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.141948 |
| Chromosome: | chromosome 12 |
| Location: | 8469287 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g548100 | UBC7 | (1 of 11) PF00632 - HECT-domain (ubiquitin-transferase) (HECT); Putative Ubiquitin-protein ligase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATCCGCAACACTTCTCTTGAACGGACA |
| Internal bar code: | CCATCCTGTTGGATCACGATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 106 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 330 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCATCTCCATTACACCCA |
| Suggested primer 2: | GATGCAGTTAGCGACAACGA |