| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.142002 |
| Chromosome: | chromosome 6 |
| Location: | 8571843 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308500 | CMP2,CMPS1 | (1 of 1) K01956 - carbamoyl-phosphate synthase small subunit (carA, CPA1); Carbamoyl phosphate synthase, small subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGGGGCAGCGTCTGCGCTGCCGACTCG |
| Internal bar code: | GCAAAGGACACAGTGCAAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 586 |
| LEAP-Seq percent confirming: | 99.7856 |
| LEAP-Seq n confirming: | 3724 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACACATGGGGTAGCTGGAG |
| Suggested primer 2: | GAGTCAGTGAAGGAGCCGAC |