Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.142024 |
Chromosome: | chromosome 17 |
Location: | 3604451 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g725950 | CSR13 | (1 of 3) K08106 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase (CHST15); Carbohydrate sulfotransferase-related 13 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTAGCGGCCTGCGCTGCGCGTTGATTGA |
Internal bar code: | CCATTCGTGGCGCCTCGGTCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 623 |
LEAP-Seq percent confirming: | 99.9456 |
LEAP-Seq n confirming: | 1836 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTTGTTGTCTCATGGCTGC |
Suggested primer 2: | ACTTCCCCTTCTCACGTCCT |