| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.142255 |
| Chromosome: | chromosome 16 |
| Location: | 5367279 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681600 | CSV14 | Chlamydomonas-specific family protein | 3'UTR |
| Cre16.g681700 | NUOS4B | (1 of 2) K03937 - NADH dehydrogenase (ubiquinone) Fe-S protein 4 (NDUFS4); NADH:ubiquinone oxidoreductase subunit | 3'UTR|intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGACTCTGCGCGGTACGACCGCCGGATT |
| Internal bar code: | AGTCAAGAGGCTCACCTCGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 370 |
| LEAP-Seq percent confirming: | 99.8672 |
| LEAP-Seq n confirming: | 3007 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGTAAGCCACTAGCTTTG |
| Suggested primer 2: | GTAAATGCAGCACCAGCAGA |