Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.142344 |
Chromosome: | chromosome 10 |
Location: | 2396615 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g435350 | ESU1,ESU1a | Endosulfine cAMP-regulated phosphoprotein; (1 of 2) PF04667 - cAMP-regulated phosphoprotein/endosulfine conserved region (Endosulfine) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTGACAGTTGCTTATGCAGAGCTGCCTT |
Internal bar code: | AGGGGCCGACAGTCCAGGCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 578 |
LEAP-Seq percent confirming: | 99.3023 |
LEAP-Seq n confirming: | 427 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGCTGCTACACAGAACCA |
Suggested primer 2: | TGCAACGCTATGGAGCTATG |