| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.142349 |
| Chromosome: | chromosome 6 |
| Location: | 2161945 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265900 | (1 of 1) K07023 - putative hydrolases of HD superfamily (K07023) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCCATGATTCACAGCAGTGCGCCTCAAG |
| Internal bar code: | GTGATGCATCCGGGTAACGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 657 |
| LEAP-Seq percent confirming: | 62.2368 |
| LEAP-Seq n confirming: | 1803 |
| LEAP-Seq n nonconfirming: | 1094 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATCTGTGACCATTGTTG |
| Suggested primer 2: | TCATTAACACGCAGGCTCAG |