| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.142413 |
| Chromosome: | chromosome 11 |
| Location: | 337989 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467569 | ATPD,ATPD1 | Chloroplast ATP synthase delta chain; (1 of 1) K02113 - F-type H+-transporting ATPase subunit delta (ATPF1D, atpH) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACAATTTTTGTGGCGCCGCTCCCAACG |
| Internal bar code: | CCCTGCGACCCCTTGACTCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 585 |
| LEAP-Seq percent confirming: | 98.9848 |
| LEAP-Seq n confirming: | 195 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATTTGACCTCGTTCGTGT |
| Suggested primer 2: | ATTGACTCCAGCCTGATTGC |