Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.142437 |
Chromosome: | chromosome 10 |
Location: | 1673359 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g429880 | CGL156 | DNA binding protein; (1 of 1) IPR001606//IPR001965//IPR003754//IPR011011//IPR019787 - ARID DNA-binding domain // Zinc finger, PHD-type // Tetrapyrrole biosynthesis, uroporphyrinogen III synthase // Zinc finger, FYVE/PHD-type // Zinc finger, PHD-finger | 3'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCGGCAGCCCGAGCACGCTCCTGACACC |
Internal bar code: | CCGGGTCGGGGGGGGTGAAGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 570 |
LEAP-Seq percent confirming: | 98.5089 |
LEAP-Seq n confirming: | 991 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCTTCATCTGTTCATCGC |
Suggested primer 2: | ATCTACCACGCAGGTGTTCC |