| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.142476 |
| Chromosome: | chromosome 6 |
| Location: | 7984246 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g303800 | (1 of 29) PF00612 - IQ calmodulin-binding motif (IQ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGAAGCATCGTTTCTAGAATGTGATTTC |
| Internal bar code: | CCATACGTTCTCGATTTCGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 372 |
| LEAP-Seq percent confirming: | 54.741 |
| LEAP-Seq n confirming: | 1120 |
| LEAP-Seq n nonconfirming: | 926 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTAATTCCCGTATTCCCG |
| Suggested primer 2: | CCTGATGTGCTTCTGGATCA |