| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.142529 |
| Chromosome: | chromosome 16 |
| Location: | 2712055 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662350 | TSPS1,TPS2 | (1 of 3) 2.4.1.15 - Alpha,alpha-trehalose-phosphate synthase (UDP-forming) / UDP-glucose--glucose-phosphate glucosyltransferase; Trehalose-6-phosphate synthase, class I | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGCATACATGTTGGCTAATGAGGAAT |
| Internal bar code: | TCAGGCATAAGTTTTGAACATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 99.5418 |
| LEAP-Seq n confirming: | 869 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGAGTGATGTGTGTGTGTG |
| Suggested primer 2: | AAATGAGACGGATGGACAGC |