Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.142552 |
Chromosome: | chromosome 6 |
Location: | 3213270 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g276050 | AKR2 | Aldo/keto reductase; (1 of 1) PTHR11732//PTHR11732:SF175 - ALDO/KETO REDUCTASE // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGAAGCAGCGCCACGGGGCGCTTGCGA |
Internal bar code: | ACCCACCACCCTGTCAATCTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 357 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCCGAGTTAGGGTCTTCC |
Suggested primer 2: | GTCAAAGTCGTGGGTCAGGT |