Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.142578 |
Chromosome: | chromosome 13 |
Location: | 992635 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g568400 | FHL4,YME1,FTSH4 | FtsH-like ATPase/metalloprotease; (1 of 1) K08955 - ATP-dependent metalloprotease [EC:3.4.24.-] (YME1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCCGGCAGCTGGCTCACCATGCCCAGC |
Internal bar code: | TGACAAACCGCGATTCTTGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 200 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 692 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTGTCAGCAACAACGACA |
Suggested primer 2: | CCTTGCGCTCTTCCTAACAC |