| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.142588 |
| Chromosome: | chromosome 6 |
| Location: | 7367096 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g299150 | PHC9,PHC26 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 26 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTTTGACCAGCCCACGGACGGCCCCGC |
| Internal bar code: | TATATAGGCCCCAGGATCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 251 |
| LEAP-Seq percent confirming: | 99.6709 |
| LEAP-Seq n confirming: | 5148 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAGGGCAACAGCCAATAC |
| Suggested primer 2: | AGGAGGAGGTGAAGGAGGAG |