Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.142617 |
Chromosome: | chromosome 9 |
Location: | 457831 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g404350 | XPO4 | Exportin 4; (1 of 1) PTHR12596//PTHR12596:SF1 - EXPORTIN 4,7-RELATED // EXPORTIN-4 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCGCACGCCCGTTCCACCGCCGCTTGA |
Internal bar code: | CGCTCCCCCCTAACTGCGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 865 |
LEAP-Seq percent confirming: | 99.5726 |
LEAP-Seq n confirming: | 1864 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCCCGCCCTAGTCTACAT |
Suggested primer 2: | CCTTGTTCTCTCCCCATCAA |