| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.142617 |
| Chromosome: | chromosome 9 |
| Location: | 457831 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404350 | XPO4 | Exportin 4; (1 of 1) PTHR12596//PTHR12596:SF1 - EXPORTIN 4,7-RELATED // EXPORTIN-4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCGCACGCCCGTTCCACCGCCGCTTGA |
| Internal bar code: | CGCTCCCCCCTAACTGCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 865 |
| LEAP-Seq percent confirming: | 99.5726 |
| LEAP-Seq n confirming: | 1864 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCCCGCCCTAGTCTACAT |
| Suggested primer 2: | CCTTGTTCTCTCCCCATCAA |