| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.142712 |
| Chromosome: | chromosome 13 |
| Location: | 4803824 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g605200 | MMP29 | Matrix metalloproteinase; (1 of 40) 3.4.24.38 - Gametolysin / Lysin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACGTACAAGATAGCATGGTGTGTCAAA |
| Internal bar code: | TAGTGCTAATCAGACCATGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 385 |
| LEAP-Seq percent confirming: | 99.4952 |
| LEAP-Seq n confirming: | 3942 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGACATTGTCGTTGGAGG |
| Suggested primer 2: | ATTCCCTATCCTCCACCACC |