| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.142771 |
| Chromosome: | chromosome 1 |
| Location: | 5493708 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g038700 | CLV5 | Voltage-gated chloride channel; (1 of 2) K05016 - chloride channel 7 (CLCN7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCAACCCTTTTATGCATATGCGTGTGTG |
| Internal bar code: | CAATCGGAAGTCGAGCGCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4 |
| LEAP-Seq percent confirming: | 26.9031 |
| LEAP-Seq n confirming: | 933 |
| LEAP-Seq n nonconfirming: | 2535 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTTGGTAGTGCGTGTGC |
| Suggested primer 2: | CTCCCAGTTGGAGATGTGGT |