| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.142910 |
| Chromosome: | chromosome 3 |
| Location: | 4202449 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174050 | MRP4 | (1 of 3) PTHR24223//PTHR24223:SF252 - FAMILY NOT NAMED // PROTEIN MRP-2; ABC transporter, multidrug resistance associated protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGGCGCCGGCACCATCGCCAACCTGCAG |
| Internal bar code: | TTCTTGACGTACTTTGAAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 282 |
| LEAP-Seq percent confirming: | 99.7156 |
| LEAP-Seq n confirming: | 1052 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACCCTCACACACACA |
| Suggested primer 2: | TCTCAACATTACTCGCACGC |