| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.142911 |
| Chromosome: | chromosome 13 |
| Location: | 2093205 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g577500 | VTI1 | (1 of 1) K08493 - vesicle transport through interaction with t-SNAREs 1 (VTI1); Endosomal Qb-SNARE, Vti1-family (Qb.III.b) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGTCCATCCCACATTTGTGCAAACGGCC |
| Internal bar code: | GGATTGACCCGCGAGTGCCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 412 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 302 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCACTGTGCTCAATTGCT |
| Suggested primer 2: | ACTCCTCCCACACACAGGAC |