| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.142943 |
| Chromosome: | chromosome 6 |
| Location: | 2312851 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267200 | NUO21 | NADH:ubiquinone oxidoreductase subunit; (1 of 1) PF10785 - NADH-ubiquinone oxidoreductase complex I, 21 kDa subunit (NADH-u_ox-rdase) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCGAAGTGTGACCGACACCGTAATCAAT |
| Internal bar code: | TTTATGCTGGTGTCCTGTCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 907 |
| LEAP-Seq percent confirming: | 99.8228 |
| LEAP-Seq n confirming: | 4507 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGAGGTTCCAGGTGTGTT |
| Suggested primer 2: | CAAGGAGAACAGCAAGGAGG |