Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.142944 |
Chromosome: | chromosome 5 |
Location: | 740739 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g248650 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATCATCGTCACATATGGCTGCGGCTGC |
Internal bar code: | TTCTGCGGGGGGGCATGTCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 84 |
LEAP-Seq percent confirming: | 77.7778 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCGGCAGTACGACAACTAT |
Suggested primer 2: | TTCGCTATGTGCTGCATTTC |