| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.142988 |
| Chromosome: | chromosome 1 |
| Location: | 4691989 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032350 | PIG8 | p53-induced protein/etoposide-induced protein 2.4; (1 of 1) K10134 - etoposide-induced 2.4 mRNA (EI24) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCCTTCAGCCCTTCGGCGTGTTCCTGA |
| Internal bar code: | CCTGGGGCGAATTATTTAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 809 |
| LEAP-Seq percent confirming: | 71.2121 |
| LEAP-Seq n confirming: | 470 |
| LEAP-Seq n nonconfirming: | 190 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACAGTAGGCGATCGTGCC |
| Suggested primer 2: | GCTTCAACCTTCGGACTCAG |