Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.143108 |
Chromosome: | chromosome 16 |
Location: | 5862111 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g677550 | CYA15 | (1 of 8) PF00211//PF01547 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_1); Solute-binding protein-like adenylate cyclase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAACACGACCAGCACCCAGCGCACTGCGC |
Internal bar code: | CGGTGAGACGACGTTTGGTGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 17 |
LEAP-Seq percent confirming: | 82.6087 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAGAGACGGCAGGAGAAC |
Suggested primer 2: | ACTTGGGAATGACATGGCTC |