| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143149 |
| Chromosome: | chromosome 7 |
| Location: | 323289 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314400 | (1 of 1) PF00580//PF13538 - UvrD/REP helicase N-terminal domain (UvrD-helicase) // UvrD-like helicase C-terminal domain (UvrD_C_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCGGGCATGTGGCCACCTAGACCCACG |
| Internal bar code: | GGTCGCCTCGGTTTGACGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1174 |
| LEAP-Seq percent confirming: | 34.9658 |
| LEAP-Seq n confirming: | 3013 |
| LEAP-Seq n nonconfirming: | 5604 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACGCTTGTCGTTTCC |
| Suggested primer 2: | GTGACTACGGTTTCCACGGT |