| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143236 |
| Chromosome: | chromosome 12 |
| Location: | 1820268 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g511950 | (1 of 1) IPR003591//IPR013210 - Leucine-rich repeat, typical subtype // Leucine-rich repeat-containing N-terminal, plant-type | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCCTGTTCCTGAACAACAACCACCTGAG |
| Internal bar code: | CAGGATAGGACACCCTCGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 636 |
| LEAP-Seq percent confirming: | 99.5267 |
| LEAP-Seq n confirming: | 2313 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTAACCCCCACTTACCCG |
| Suggested primer 2: | TACTGATGAGCAGTGTCGGC |