| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.143246 |
| Chromosome: | chromosome 13 |
| Location: | 2175559 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g578051 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATACGCCAACCTCCTCGCCTCCTCACT |
| Internal bar code: | GCTCGGACACGCGGGTGGGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1043 |
| LEAP-Seq percent confirming: | 97.867 |
| LEAP-Seq n confirming: | 780 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGGACGGTTTGTTAGTTA |
| Suggested primer 2: | GCCATCACGTATCCAGCTTT |