| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143274 |
| Chromosome: | chromosome 8 |
| Location: | 4087194 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g379550 | MFT11,PHT4,PHT4-4,PHT4D | Sodium-dependent phosphate transporter, major facilitator superfamily; (1 of 4) K08193 - MFS transporter, ACS family, solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), other (SLC17A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATTCCACCACCACCGCCACCACCCCGCA |
| Internal bar code: | CCCCGCCTTGCTGACACGCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 544 |
| LEAP-Seq percent confirming: | 94.382 |
| LEAP-Seq n confirming: | 168 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGTTTGAAAGCAATCGGG |
| Suggested primer 2: | CCGAAGTTGTTGACCATGTG |