Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.143300 |
Chromosome: | chromosome 14 |
Location: | 1664686 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g619166 | CSK6 | Casein kinase II-related Ser/Thr kinase, alpha chain; (1 of 3) K03097 - casein kinase II subunit alpha (CSNK2A) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAAAGCCTGTCGGCCGGCACCATGCTCC |
Internal bar code: | GCGATCGGGTCAAGTCGGGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 882 |
LEAP-Seq percent confirming: | 98.8934 |
LEAP-Seq n confirming: | 13495 |
LEAP-Seq n nonconfirming: | 151 |
LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGTACTAGAGCTGCATCC |
Suggested primer 2: | TCTTTGCTAGCCAACGTCCT |