| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143327 |
| Chromosome: | chromosome 10 |
| Location: | 2484541 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436150 | COA6,COAE1 | (1 of 1) K00859 - dephospho-CoA kinase (coaE); Dephospho-CoA kinase, CoA biosynthesis | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCGAGAGCCTGCACATCGGCCCGCGTG |
| Internal bar code: | GAGACGGGACAAAGCCATTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 676 |
| LEAP-Seq percent confirming: | 99.9503 |
| LEAP-Seq n confirming: | 2011 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGGAGGGACTGTGTGGAC |
| Suggested primer 2: | AGCAATGCACAGATGCTCAC |