Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.143330 |
Chromosome: | chromosome 16 |
Location: | 892765 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g648200 | CYP744C1,CYP35 | (1 of 3) K01832 - thromboxane-A synthase (TBXAS1, CYP5A); Cytochrome P450, CYP3 superfamily | intron|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAGAGGGAGGAATGCTTGTTGCTCGGGT |
Internal bar code: | CGAAGAGGGCGCGCTTGCATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 544 |
LEAP-Seq percent confirming: | 99.7301 |
LEAP-Seq n confirming: | 4064 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCACTGTGCATAATCGCTG |
Suggested primer 2: | GATGGACTCGTCGTCCACTT |