| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.143344 |
| Chromosome: | chromosome 12 |
| Location: | 9089377 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g542800 | RPC2 | DNA-directed RNA polymerase III, subunit 2; (1 of 1) K03021 - DNA-directed RNA polymerase III subunit RPC2 (RPC2, POLR3B) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGCAGGTTGGTGAAGTCCCGTAAGAT |
| Internal bar code: | CATGGAGGCAGCGCTTTTAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 520 |
| LEAP-Seq percent confirming: | 94.1159 |
| LEAP-Seq n confirming: | 3135 |
| LEAP-Seq n nonconfirming: | 196 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGAAGCGGTATAGGATCA |
| Suggested primer 2: | GGTCTGTCTCGTGCTTGTCA |