| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143405 |
| Chromosome: | chromosome 5 |
| Location: | 1471641 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243800 | CPLD45,PSB27 | (1 of 1) K08902 - photosystem II Psb27 protein (psb27); conserved expressed protein involved in PSII biogenesis | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAAACGGATCGACAAAAAACGGGAGCTCA |
| Internal bar code: | TCGGATCCGCGACTGAGACGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 704 |
| LEAP-Seq percent confirming: | 69.8113 |
| LEAP-Seq n confirming: | 444 |
| LEAP-Seq n nonconfirming: | 192 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGTAGATGACCCTGACC |
| Suggested primer 2: | TACCAGCCCAAACTTAACCG |