Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.143432 |
Chromosome: | chromosome 10 |
Location: | 706274 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g422450 | GGT1,PGSIP6 | (1 of 1) PTHR11183//PTHR11183:SF39 - GLYCOGENIN // PROTEIN GYG-1, ISOFORM A; Plant glycogenin-like starch initiation protein 6 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAACCCACAAACGCACACAACGCCACCT |
Internal bar code: | TTAGCGGTCTTGGTGTAGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 138 |
LEAP-Seq percent confirming: | 99.4292 |
LEAP-Seq n confirming: | 871 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTGCACATCAACTCCTTC |
Suggested primer 2: | GGGAAATCTCAGATGCCAAA |