| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143432 |
| Chromosome: | chromosome 10 |
| Location: | 706280 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g422450 | GGT1,PGSIP6 | (1 of 1) PTHR11183//PTHR11183:SF39 - GLYCOGENIN // PROTEIN GYG-1, ISOFORM A; Plant glycogenin-like starch initiation protein 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCCGAGTGCGGTTAGTGGCACGGGTAC |
| Internal bar code: | CAGTCCGGGGTTCTGCTGTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 820 |
| LEAP-Seq percent confirming: | 99.7351 |
| LEAP-Seq n confirming: | 6776 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGCACATCAACTCCTTC |
| Suggested primer 2: | GGGAAATCTCAGATGCCAAA |