| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143476 |
| Chromosome: | chromosome 8 |
| Location: | 3369959 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g374250 | SAG1 | (1 of 80) IPR003882 - Pistil-specific extensin-like protein; Plus agglutinin protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCATACACAATTAAGCTCTCCCTTACC |
| Internal bar code: | TAAATCGGTATTCGACTACCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 50 |
| LEAP-Seq percent confirming: | 33.7531 |
| LEAP-Seq n confirming: | 134 |
| LEAP-Seq n nonconfirming: | 263 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | CACTGATACAACCGACAGCG |