| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.143485 |
| Chromosome: | chromosome 12 |
| Location: | 1161844 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490050 | TPT18,GMT1,TPT19 | (1 of 3) K15356 - GDP-mannose transporter (VRG4, GONST1); Putative GDP-mannose transporter | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCTTGACAGGTCGACGCTGCGACGTTTT |
| Internal bar code: | TCTAACCTGTGGGGGTCGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 753 |
| LEAP-Seq percent confirming: | 99.9365 |
| LEAP-Seq n confirming: | 3148 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGAGAGAAGTGGGAGCA |
| Suggested primer 2: | ACCCACTTGACAAAACCAGC |