Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.143490 |
Chromosome: | chromosome 11 |
Location: | 497535 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467597 | (1 of 1) IPR000104//IPR003439//IPR003593//IPR013525//IPR013581//IPR027417 - Antifreeze protein, type I // ABC transporter-like // AAA+ ATPase domain // ABC-2 type transporter // Plant PDR ABC transporter associated // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGGTTTCTGAGAAGGACAGGGGGAGGT |
Internal bar code: | GAGTATTAAGGGTACTGTGACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 157 |
LEAP-Seq percent confirming: | 96.1094 |
LEAP-Seq n confirming: | 914 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACATCCTCTCCCTCACAT |
Suggested primer 2: | AGTGGATGTCCATCTGCTCC |