| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.143536 |
| Chromosome: | chromosome_11 |
| Location: | 1702885 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre11.g467781 | FAP151 | ABC transporter-like and Flagellar Associated Protein | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GGAGGGTTGGGAGGGAGGGAGGGGGCTGCG |
| Internal bar code: | ACTGCTCACCCCGGCTCTCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1224 |
| LEAP-Seq percent confirming: | 99.356 |
| LEAP-Seq n confirming: | 1080 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAACGCCAAGTTCGCTAGG |
| Suggested primer 2: | AGTCTCGAATCCCCACACAC |