Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.143536 |
Chromosome: | chromosome_11 |
Location: | 1702885 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre11.g467781 | FAP151 | ABC transporter-like and Flagellar Associated Protein | sense | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | GGAGGGTTGGGAGGGAGGGAGGGGGCTGCG |
Internal bar code: | ACTGCTCACCCCGGCTCTCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1224 |
LEAP-Seq percent confirming: | 99.356 |
LEAP-Seq n confirming: | 1080 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAACGCCAAGTTCGCTAGG |
Suggested primer 2: | AGTCTCGAATCCCCACACAC |