| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143649 |
| Chromosome: | chromosome 5 |
| Location: | 2271055 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234665 | AP4B4 | Beta4-Adaptin; (1 of 1) PTHR11134:SF4 - AP-4 COMPLEX SUBUNIT BETA-1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTCGGGGGCCGTTGAGGGGGTATCTGCT |
| Internal bar code: | GTGGTGGCTGCCACGCGGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 525 |
| LEAP-Seq percent confirming: | 99.7846 |
| LEAP-Seq n confirming: | 1853 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTTCTACGGCCAGACGCT |
| Suggested primer 2: | ATCTTACCCATTCAGGCACG |