| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143662 |
| Chromosome: | chromosome 16 |
| Location: | 3035812 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665050 | CAV2 | (1 of 1) IPR000048//IPR002077//IPR005821 - IQ motif, EF-hand binding site // Voltage-dependent calcium channel, alpha-1 subunit // Ion transport domain; Voltage-gated Ca2+ channel, alpha subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACGCGCTGCGCCAAACCCCCAGGCCGT |
| Internal bar code: | GAGCGCGAGTGTGCCTCAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 909 |
| LEAP-Seq percent confirming: | 97.8032 |
| LEAP-Seq n confirming: | 8815 |
| LEAP-Seq n nonconfirming: | 198 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGACTGCGCAAATCTGTCT |
| Suggested primer 2: | CATGTACCCCTGTCCGTACC |