Insertion junction: LMJ.RY0402.143677_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.143677
Chromosome:chromosome_3
Location:8322352
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g199000 PHT1,PHOT,PHOT1 Phototropin antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ATCAGGATTAACTAAATGCTTAGGGTTGGT
Internal bar code:GTTCGATATCGCCCAGCGGTCC

Confirmation - LEAP-Seq

LEAP-Seq distance:923
LEAP-Seq percent confirming:98.3299
LEAP-Seq n confirming:11304
LEAP-Seq n nonconfirming:192
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR

Suggested primer 1:GAAGCGTTACACCGGACAAT
Suggested primer 2:AAGATGCTACTGATGCCGCT