| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.143681 |
| Chromosome: | chromosome 8 |
| Location: | 935295 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g361800 | RPC31 | (1 of 1) PF11705 - DNA-directed RNA polymerase III subunit Rpc31 (RNA_pol_3_Rpc31); DNA-directed RNA polymerase III | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGAACACCTCTTCGATAATACAACAAG |
| Internal bar code: | GGGGCGAACTTCCCGGAAACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 499 |
| LEAP-Seq percent confirming: | 48.1117 |
| LEAP-Seq n confirming: | 586 |
| LEAP-Seq n nonconfirming: | 632 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGACCTCCACGTTGTCTT |
| Suggested primer 2: | CTCTTCTTTCCCTGGCTGTG |