| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.143762 |
| Chromosome: | chromosome 9 |
| Location: | 7264618 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g412600 | CYG52 | (1 of 1) PF00072//PF00211 - Response regulator receiver domain (Response_reg) // Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc); Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCATTGTGGGGTTTCCAGCTCCATCCT |
| Internal bar code: | TGGCAGTGCAAGCCGACTGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 265 |
| LEAP-Seq percent confirming: | 86.0212 |
| LEAP-Seq n confirming: | 13415 |
| LEAP-Seq n nonconfirming: | 2180 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAGTCACCAGCAGCAGTC |
| Suggested primer 2: | CTTTTTCCTCCGTTTCCTCC |