| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.143987 |
| Chromosome: | chromosome 16 |
| Location: | 2952733 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g664150 | PDE18 | (1 of 3) 3.1.4.17//3.1.4.53 - 3',5'-cyclic-nucleotide phosphodiesterase / Cyclic AMP phosphodiesterase // 3',5'-cyclic-AMP phosphodiesterase / cAMP-specific phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAGACACCGACAGCGACAGTTAGCTGA |
| Internal bar code: | CGCGTAGGTTCGACAACCAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 886 |
| LEAP-Seq percent confirming: | 98.7851 |
| LEAP-Seq n confirming: | 2846 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACTTGTGTGCATGCCTT |
| Suggested primer 2: | TTTGTGGCTCTAGCATGTCG |